Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circMAN2B2/hsa_circRNA_103595 | |||
Gene | MAN2B2 | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Lung Cancer | ICD-10 | Malignant neoplasm of bronchus and lung (C34) |
DBLink | Link to database | PMID | 29550475 |
Experimental Method | |||
Sample Type | Tissues and Cell lines | Comparison | lung tissues and human lung cell line BESA-2B and four lung cancer cell lines(A549, H226, H1299 and H446) |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CAGGACATTTTGCCTCGGTCT3 ReverseGGTGCGTTGCGTACATGTCTC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Ma, X, Yang, X, Bao, W, Li, S, Liang, S, Sun, Y, Zhao, Y, Wang, J, Zhao, C (2018). Circular RNA circMAN2B2 facilitates lung cancer cell proliferation and invasion via miR-1275/FOXK1 axis. Biochem. Biophys. Res. Commun., 498, 4:1009-1015. |